Stem-loop sequence tch-mir-20a

AccessionMI0031232 (change log)
DescriptionTupaia chinensis miR-20a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   ---ua                 g   -  uu 
5'      aagugcuuauagugcag uag ug  u
        ||||||||||||||||| ||| ||   
3'      uucacgaguauuacguc auc au  a
   ugaaa                 -   u  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320410.1: 3473624-3473682 [+]
intergenic
Clustered miRNAs
< 10kb from tch-mir-20a
tch-mir-17KB320410.1: 3473178-3473237 [+]
tch-mir-19aKB320410.1: 3473460-3473518 [+]
tch-mir-20aKB320410.1: 3473624-3473682 [+]
tch-mir-19b-1KB320410.1: 3473759-3473819 [+]
tch-mir-92a-1KB320410.1: 3473876-3473934 [+]
Database links

Mature sequence tch-miR-20a-5p

Accession MIMAT0036569
Sequence

1 - 

uaaagugcuuauagugcaggua

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1