Stem-loop sequence tch-mir-146a

AccessionMI0031230 (change log)
DescriptionTupaia chinensis miR-146a stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   --u            c        --g  u 
5'    gagaacugaauu cauggguu   ug c
      |||||||||||| ||||||||   ||  
3'    uucuugacuuaa guguccag   gc a
   gac            a        acu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB364593.1: 1588319-1588376 [-]
intergenic
Database links

Mature sequence tch-miR-146a-5p

Accession MIMAT0036567
Sequence

1 - 

ugagaacugaauuccauggguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1