Stem-loop sequence tch-mir-127

AccessionMI0031219 (change log)
DescriptionTupaia chinensis miR-127 stem-loop
Gene family MIPF0000080; mir-127
Stem-loop
   -cug         g  c      --  a 
5'     aagcucaga gg ucugau  uc g
       ||||||||| || ||||||  || a
3'     uucgagucu cc aggcua  ag a
   ucgg         g  u      cu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB321140.1: 4730686-4730741 [+]
intergenic
Clustered miRNAs
< 10kb from tch-mir-127
tch-mir-127KB321140.1: 4730686-4730741 [+]
tch-mir-432KB321140.1: 4732181-4732249 [+]
tch-mir-136KB321140.1: 4732398-4732453 [+]
Database links

Mature sequence tch-miR-127-3p

Accession MIMAT0036559
Sequence

35 - 

ucggauccgucugagcuuggcu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1