Stem-loop sequence tch-mir-26b

AccessionMI0031210 (change log)
DescriptionTupaia chinensis miR-26b stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
   -u         uc           u ug 
5'   ucaaguaau  aggauagguug g  c
     |||||||||  ||||||||||| |   
3'   gguucauua  ucuuguccgac c  u
   uc         cc           - ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB321002.1: 45434-45489 [-]
intergenic
Database links

Mature sequence tch-miR-26b-5p

Accession MIMAT0036550
Sequence

1 - 

uucaaguaauucaggauagguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1