Stem-loop sequence tch-mir-365a-1

AccessionMI0031208 (change log)
DescriptionTupaia chinensis miR-365a-1 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   --     c           ga    uuacca 
5'   aggga uuuugggggca  ugug      u
     ||||| |||||||||||  ||||      u
3'   uuccu aaaauccccgu  auac      c
   ua     a           -a    caucac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320604.1: 5385712-5385773 [+]
intergenic
Clustered miRNAs
< 10kb from tch-mir-365a-1
tch-mir-193bKB320604.1: 5380778-5380836 [+]
tch-mir-365a-1KB320604.1: 5385712-5385773 [+]
tch-mir-365a-2KB320604.1: 5392075-5392136 [+]
Database links

Mature sequence tch-miR-365a-3p

Accession MIMAT0036548
Sequence

41 - 

uaaugccccuaaaaauccuuau

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1