Stem-loop sequence tch-mir-135b

AccessionMI0031176 (change log)
DescriptionTupaia chinensis miR-135b stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   --          cau          --   cu 
5'   uauggcuuuu   uccuauguga  uug  g
     ||||||||||   ||||||||||  |||   
3'   guaccgaaaa   gggauguacu  aac  u
   gg          -uc          ca   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB321094.1: 3860853-3860913 [-]
intergenic
Database links

Mature sequence tch-miR-135b-5p

Accession MIMAT0036518
Sequence

1 - 

uauggcuuuucauuccuauguga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1