Stem-loop sequence tch-mir-29a

AccessionMI0031169 (change log)
DescriptionTupaia chinensis miR-29a stem-loop
Gene family MIPF0000009; mir-29
Literature search

1 open access papers mention tch-mir-29a
(2 sentences)

Stem-loop
   -         uuu       c    ucaa 
5'  acugauuuc   ugguguu agag    u
    |||||||||   ||||||| ||||    a
3'  uggcuaaag   accacga ucuu    u
   u         ucu       -    uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB321076.1: 2051594-2051652 [-]
intergenic
Clustered miRNAs
< 10kb from tch-mir-29a
tch-mir-29b-2KB321076.1: 2051945-2052008 [-]
tch-mir-29aKB321076.1: 2051594-2051652 [-]
Database links

Mature sequence tch-miR-29a-3p

Accession MIMAT0036511
Sequence

39 - 

uagcaccaucugaaaucgguu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1