Stem-loop sequence tch-mir-34a-1

AccessionMI0031168 (change log)
DescriptionTupaia chinensis miR-34a-1 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   --u        -   a          gugagaaa 
5'    ggcagugu cuu gcugguuguu        u
      |||||||| ||| ||||||||||         
3'    ccgucaua gaa cgacuaacga        a
   auc        u   -          aggaagug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320563.1: 14668166-14668231 [+]
intergenic
Clustered miRNAs
< 10kb from tch-mir-34a-1
tch-mir-34a-1KB320563.1: 14668166-14668231 [+]
tch-mir-34a-2KB320563.1: 14669440-14669505 [+]
Database links

Mature sequence tch-miR-34a-5p

Accession MIMAT0036510
Sequence

1 - 

uggcagugucuuagcugguuguu

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1