Stem-loop sequence tch-mir-365b

AccessionMI0031154 (change log)
DescriptionTupaia chinensis miR-365b stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   --     c   c       -----    u   u 
5'   aggga uuu aggggca     gcug guu c
     ||||| ||| |||||||     |||| |||  
3'   uuccu aaa uccccgu     ugac cag c
   ua     a   a       aauac    u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320856.1: 303568-303628 [+]
intergenic
Database links

Mature sequence tch-miR-365b-3p

Accession MIMAT0036498
Sequence

40 - 

uaaugccccuaaaaauccuuau

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1