Stem-loop sequence tch-mir-29b-1

AccessionMI0031151 (change log)
DescriptionTupaia chinensis miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   ----         c      g  u    uuuucc 
5'     cugguuuca auggug cu agau      a
       ||||||||| |||||| || ||||       
3'     gacuaaagu uaccac ga ucua      u
   uugu         u      -  -    uguuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB321094.1: 6017770-6017833 [-]
intergenic
Clustered miRNAs
< 10kb from tch-mir-29b-1
tch-mir-29b-1KB321094.1: 6017770-6017833 [-]
tch-mir-29cKB321094.1: 6017188-6017244 [-]
Database links

Mature sequence tch-miR-29b-3p

Accession MIMAT0036494
Sequence

42 - 

uagcaccauuugaaaucaguguu

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1