Stem-loop sequence tch-mir-184

AccessionMI0031150 (change log)
DescriptionTupaia chinensis miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   --        c      a c     -   gug 
5'   ccuuauca uuuucc g ccagc uuu   a
     |||||||| |||||| | ||||| |||    
3'   ggaauagu aagagg c gguug gag   c
   ug        c      - a     u   ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TupChi_1.0; GCA_000334495.1) Overlapping transcripts
KB320486.1: 2582295-2582356 [+]
intergenic
Database links

Mature sequence tch-miR-184

Accession MIMAT0036493
Sequence

41 - 

uggacggagaacugauaagggu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1