Stem-loop sequence gga-mir-7458-2

AccessionMI0031113 (change log)
DescriptionGallus gallus miR-7458-2 stem-loop
Gene family MIPF0002082; mir-7458
Stem-loop
   --    g  acaagu      -   a  ccucc 
5'   uugc ga      ucucag ggc gc     a
     |||| ||      |||||| ||| ||      
3'   gacg cu      aggguc ccg ug     u
   ga    a  -cuacu      a   g  aacac 
Get sequence
Deep sequencing
311 reads, 200 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 56324867-56324930 [+]
intergenic
Database links

Mature sequence gga-miR-7458-5p

Accession MIMAT0029070
Sequence

1 - 

uugcggaacaaguucucagggc

 - 22

Get sequence
Deep sequencing612 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-7458-3p

Accession MIMAT0029071
Sequence

43 - 

cacugggaucaucucagcagag

 - 64

Get sequence
Deep sequencing10 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).