Stem-loop sequence ppy-mir-515-3

AccessionMI0031101 (change log)
DescriptionPongo pygmaeus miR-515-3 stem-loop
Gene family MIPF0000020; mir-515
Literature search

1 open access papers mention ppy-mir-515-3
(2 sentences)

Stem-loop
   ----- ug a   a aaga     ug    c  u           a    uu      gu 
5'      u  g gug g    ucuca  uagu au cuccaaaagaa gcac  ucuguu  c
        |  | ||| |    |||||  |||| || ||||||||||| ||||  ||||||  u
3'      a  u cac c    agagu  guca ug gagguuuucuu cgug  agacga  g
   guuga gu g   - aaaa     uu    u  c           c    --      aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 55453959-55454073 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-515-3
ppy-mir-512-2chr19: 55444850-55444947 [+]
ppy-mir-1323chr19: 55446306-55446378 [+]
ppy-mir-498chr19: 55448578-55448701 [+]
ppy-mir-520echr19: 55450076-55450162 [+]
ppy-mir-515-3chr19: 55453959-55454073 [+]
ppy-mir-519echr19: 55454916-55455002 [+]
ppy-mir-520fchr19: 55457107-55457193 [+]
ppy-mir-515-1chr19: 55460257-55460339 [+]
ppy-mir-526achr19: 55461733-55461798 [+]
ppy-mir-1283achr19: 55463738-55463824 [+]
Database links

Mature sequence ppy-miR-515-5p

Accession MIMAT0015943
Sequence

28 - 

uucuccaaaagaaagcacuuucug

 - 51

Get sequence
Evidence not experimental

Mature sequence ppy-miR-515-3p

Accession MIMAT0015944
Sequence

65 - 

gagugccuucuuuuggagcguu

 - 86

Get sequence
Evidence not experimental

References

1
PMID:24126940 "Exploration of miRNA families for hypotheses generation" Kamanu TK, Radovanovic A, Archer JA, Bajic VB Sci Rep. 3:2940(2013).