Stem-loop sequence mml-mir-519a-2

AccessionMI0031097 (change log)
DescriptionMacaca mulatta miR-519a-2 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   gugcuggagcaagaaga         c   c            a         -g  guc 
5'                  ucucaggcu uaa ccucuagaggga gcgcuuucu  uc   u
                    ||||||||| ||| |||||||||||| |||||||||  ||    
3'                  agaguuugg auu ggagauuuuccu cgugaaaga  ag   g
   --gaagugguaacgaaa         c   a            a         ag  aga 
Get sequence
Deep sequencing
1456 reads, 50 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49039745-49039863 [+]
sense
Clustered miRNAs
< 10kb from mml-mir-519a-2
mml-mir-519cchr19: 49030112-49030198 [+]
mml-mir-1283chr19: 49032979-49033088 [+]
mml-mir-520achr19: 49034604-49034688 [+]
mml-mir-526bchr19: 49038951-49039033 [+]
mml-mir-519a-2chr19: 49039745-49039863 [+]
mml-mir-525chr19: 49042145-49042230 [+]
mml-mir-523achr19: 49042991-49043077 [+]
mml-mir-518fchr19: 49044960-49045046 [+]
mml-mir-519achr19: 49046135-49046219 [+]
mml-mir-518bchr19: 49048495-49048577 [+]
Database links

Mature sequence mml-miR-519a

Accession MIMAT0036445
Sequence

33 - 

cucuagagggaagcgcuuucug

 - 54

Get sequence
Deep sequencing289 reads, 5 experiments
Evidence not experimental
Predicted targets

References

1
PMID:24126940 "Exploration of miRNA families for hypotheses generation" Kamanu TK, Radovanovic A, Archer JA, Bajic VB Sci Rep. 3:2940(2013).