Stem-loop sequence ggo-mir-520f

AccessionMI0031069 (change log)
DescriptionGorilla gorilla miR-520f stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   ------------------     u                        u  gugg  a 
5'                   caggc gugacccucuaaagggaagcgcuu cu    uc g
                     ||||| |||||||||||||||||||||||| ||    || a
3'                   guuug cauugggagauuuuccuucgugaa ga    ag a
   gaaguuguaacgaaaagg     c                        c  --aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr19: 53025391-53025489 [+]
sense
Clustered miRNAs
< 10kb from ggo-mir-520f
ggo-mir-515-1chr19: 53019793-53019907 [+]
ggo-mir-519echr19: 53020783-53020902 [+]
ggo-mir-520fchr19: 53025391-53025489 [+]
ggo-mir-515-2chr19: 53028222-53028336 [+]
Database links

Mature sequence ggo-miR-520f

Accession MIMAT0036409
Sequence

52 - 

aagugcuuccuuuuagaggguu

 - 73

Get sequence
Evidence not experimental

References

1
PMID:24126940 "Exploration of miRNA families for hypotheses generation" Kamanu TK, Radovanovic A, Archer JA, Bajic VB Sci Rep. 3:2940(2013).