Stem-loop sequence ggo-mir-519e

AccessionMI0031068 (change log)
DescriptionGorilla gorilla miR-519e stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   ---   g   cgagaaga     u     c  u   c      ga      uc    g  u 
5'    uuu gag        ucuca gcagu au cuc aaaagg  gcacuu  uguu uc g
      ||| |||        ||||| ||||| || ||| ||||||  ||||||  |||| || a
3'    gaa uuc        agagu uguca ug gag uuuucc  cgugaa  acaa ag a
   guu   g   caccaaaa     u     u  u   a      uc      --    a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr19: 53020783-53020902 [+]
intergenic
CABD030163092.1: 328-447 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-519e
ggo-mir-515-1chr19: 53019793-53019907 [+]
ggo-mir-519echr19: 53020783-53020902 [+]
ggo-mir-520fchr19: 53025391-53025489 [+]
ggo-mir-515-2chr19: 53028222-53028336 [+]
Database links

Mature sequence ggo-miR-519e-5p

Accession MIMAT0036407
Sequence

29 - 

uucuccaaaagggagcacuuuc

 - 50

Get sequence
Evidence not experimental

Mature sequence ggo-miR-519e-3p

Accession MIMAT0036408
Sequence

70 - 

aagugccuccuuuuagaguguu

 - 91

Get sequence
Evidence not experimental

References

1
PMID:24126940 "Exploration of miRNA families for hypotheses generation" Kamanu TK, Radovanovic A, Archer JA, Bajic VB Sci Rep. 3:2940(2013).