Stem-loop sequence ggo-mir-515-1

AccessionMI0031067 (change log)
DescriptionGorilla gorilla miR-515-1 stem-loop
Gene family MIPF0000020; mir-515
Literature search

1 open access papers mention ggo-mir-515-1
(2 sentences)

Stem-loop
   ----- ug a   a aaga     u     c  u           a    uu      gu 
5'      u  g gcg g    ucuca gcagu au cuccaaaagaa gcac  ucuguu  c
        |  | ||| |    ||||| ||||| || ||||||||||| ||||  ||||||  u
3'      a  u cgc c    agagu uguca ug gagguuuucuu cgug  agacga  g
   guuga gu g   - aaaa     u     u  c           c    --      aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr19: 53019793-53019907 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-515-1
ggo-mir-515-1chr19: 53019793-53019907 [+]
ggo-mir-519echr19: 53020783-53020902 [+]
ggo-mir-520fchr19: 53025391-53025489 [+]
ggo-mir-515-2chr19: 53028222-53028336 [+]
Database links

Mature sequence ggo-miR-515-5p

Accession MIMAT0036405
Sequence

28 - 

uucuccaaaagaaagcacuuucug

 - 51

Get sequence
Evidence not experimental

Mature sequence ggo-miR-515-3p

Accession MIMAT0036406
Sequence

65 - 

gagugccuucuuuuggagcguu

 - 86

Get sequence
Evidence not experimental

References

1
PMID:24126940 "Exploration of miRNA families for hypotheses generation" Kamanu TK, Radovanovic A, Archer JA, Bajic VB Sci Rep. 3:2940(2013).