![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR9763 |
|||||
Accession | MI0031062 (change log) | ||||
Description | Glycine max miR9763 stem-loop | ||||
Literature search |
1 open access papers mention gma-MIR9763 | ||||
Stem-loop |
- ca u ua a a 5' uccaaacc uccaacucugaagauaau ugguuca guu uc a |||||||| |||||||||||||||||| ||||||| ||| || 3' ggguuugg agguugagauuucuauua accaagu caa ag g u uc u -- - a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR9763 |
|
Accession | MIMAT0036400 |
Sequence |
6 - acccauccaacucugaagaua - 26 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|