Stem-loop sequence gma-MIR399i

AccessionMI0031044 (change log)
DescriptionGlycine max miR399i stem-loop
Gene family MIPF0000015; MIR399
Literature search

14 open access papers mention gma-MIR399i
(87 sentences)

Stem-loop
   gaauaa   u                   --u   ----g      u 
5'       cag gcaauucuccuuuggcagg   guu     caugug u
         ||| |||||||||||||||||||   |||     ||||||  
3'       guc cguuaagaggaaaccgucu   cag     guacgc c
   -uuacc   c                   uuc   uaaga      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 6566664-6566752 [+]
intergenic
Database links

Mature sequence gma-miR399i

Accession MIMAT0036382
Sequence

64 - 

ugccaaaggagaauugcccug

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1