Stem-loop sequence gma-MIR4348b

AccessionMI0031006 (change log)
DescriptionGlycine max miR4348b stem-loop
Gene family MIPF0001966; MIR4348
Literature search

1 open access papers mention gma-MIR4348b
(1 sentences)

Stem-loop
         g           c          u           a  c               gugauauuguagugguuauagauauaaaagugacuuucuacauguuuaaa 
5' uagaaa uaauagucaaa ucaaaagaua ugaaagauuau ug uagacuuguaggaug                                                  g
   |||||| ||||||||||| |||||||||| ||||||||||| || |||||||||||||||                                                  c
3' aucuuu auuaucaguuu aguuuucuau auuuucuaaua ac guuugaacauuuuac                                                  u
         g           a          u           c  a               ugguguguaauaccacuaacacuuacauccaaugaaaaauguaaccaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 38820668-38820890 [+]
intergenic
Database links

Mature sequence gma-miR4348b

Accession MIMAT0036344
Sequence

197 - 

ucuuuugaauuugacuauuag

 - 217

Get sequence
Evidence experimental; Illumina [1]

References

1