Stem-loop sequence ocu-mir-191

AccessionMI0030998 (change log)
DescriptionOryctolagus cuniculus miR-191 stem-loop
Gene family MIPF0000194; mir-191
Literature search

1 open access papers mention ocu-mir-191
(1 sentences)

Stem-loop
   c   u   c      c          c  aa       uu  -  c 
5'  ggc gga agcggg aacggaaucc aa  gcagcug  gu cu c
    ||| ||| |||||| |||||||||| ||  |||||||  || ||  
3'  ccg ccu ucgucc uugcuuuagg uu  cgucgac  ua ga a
   u   u   u      c          -  cg       cu  c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000798.1: 16649737-16649828 [-]
intergenic
Clustered miRNAs
< 10kb from ocu-mir-191
ocu-mir-191CM000798.1: 16649737-16649828 [-]
ocu-mir-425CM000798.1: 16649322-16649384 [-]
Database links

Mature sequence ocu-miR-191-5p

Accession MIMAT0036335
Sequence

16 - 

caacggaaucccaaaagcagcug

 - 38

Get sequence
Evidence experimental; SOLiD [1], Illumina [2]

Mature sequence ocu-miR-191-3p

Accession MIMAT0036336
Sequence

58 - 

gcugcgcuuggauuucguuccc

 - 79

Get sequence
Evidence experimental; SOLiD [1], Illumina [2]

References

1
PMID:23426804 "Discovery of pluripotency-associated microRNAs in rabbit preimplantation embryos and embryonic stem-like cells" Maraghechi P, Hiripi L, Toth G, Bontovics B, Bosze Z, Gocza E Reproduction. 145:421-437(2013).
2
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).