Stem-loop sequence ocu-mir-302d

AccessionMI0030990 (change log)
DescriptionOryctolagus cuniculus miR-302d stem-loop
Gene family MIPF0000071; mir-302
Literature search

1 open access papers mention ocu-mir-302d
(1 sentences)

Stem-loop
   u  c     u                cugugcc 
5'  cu uacuu aacauggaggcacuug       a
    || ||||| ||||||||||||||||       u
3'  gg gugag uuguaccuucgugaau       g
   -  u     u                aaaaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000804.1: 36770109-36770176 [+]
sense
antisense
ENSOCUT00000007074 ; LARP7-201; intron 9
Clustered miRNAs
< 10kb from ocu-mir-302d
ocu-mir-302bCM000804.1: 36769627-36769706 [+]
ocu-mir-302cCM000804.1: 36769770-36769837 [+]
ocu-mir-302aCM000804.1: 36769946-36770014 [+]
ocu-mir-302dCM000804.1: 36770109-36770176 [+]
ocu-mir-367CM000804.1: 36770233-36770300 [+]
Database links

Mature sequence ocu-miR-302d-5p

Accession MIMAT0036322
Sequence

6 - 

acuuuaacauggaggcacuugc

 - 27

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ocu-miR-302d-3p

Accession MIMAT0036323
Sequence

44 - 

uaagugcuuccauguuugagugu

 - 66

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:23426804 "Discovery of pluripotency-associated microRNAs in rabbit preimplantation embryos and embryonic stem-like cells" Maraghechi P, Hiripi L, Toth G, Bontovics B, Bosze Z, Gocza E Reproduction. 145:421-437(2013).