Stem-loop sequence ocu-mir-302a

AccessionMI0030989 (change log)
DescriptionOryctolagus cuniculus miR-302a stem-loop
Gene family MIPF0000071; mir-302
Literature search

1 open access papers mention ocu-mir-302a
(1 sentences)

Stem-loop
      c    u         u           gaa 
5' cca cacu aaacgugga guacuugcuuu   a
   ||| |||| ||||||||| |||||||||||   c
3' ggu gugg uuuguaccu cgugaaugaaa   u
      a    u         u           aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000804.1: 36769946-36770014 [+]
antisense
ENSOCUT00000007074 ; LARP7-201; intron 9
Clustered miRNAs
< 10kb from ocu-mir-302a
ocu-mir-302bCM000804.1: 36769627-36769706 [+]
ocu-mir-302cCM000804.1: 36769770-36769837 [+]
ocu-mir-302aCM000804.1: 36769946-36770014 [+]
ocu-mir-302dCM000804.1: 36770109-36770176 [+]
ocu-mir-367CM000804.1: 36770233-36770300 [+]
Database links

Mature sequence ocu-miR-302a-5p

Accession MIMAT0036320
Sequence

6 - 

acuuaaacguggauguacuugcu

 - 28

Get sequence
Evidence experimental; SOLiD [1], Illumina [2]

Mature sequence ocu-miR-302a-3p

Accession MIMAT0036321
Sequence

44 - 

uaagugcuuccauguuuugguga

 - 66

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:23426804 "Discovery of pluripotency-associated microRNAs in rabbit preimplantation embryos and embryonic stem-like cells" Maraghechi P, Hiripi L, Toth G, Bontovics B, Bosze Z, Gocza E Reproduction. 145:421-437(2013).
2
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).