Stem-loop sequence ocu-mir-302c

AccessionMI0030988 (change log)
DescriptionOryctolagus cuniculus miR-302c stem-loop
Gene family MIPF0000071; mir-302
Literature search

1 open access papers mention ocu-mir-302c
(1 sentences)

Stem-loop
       ug  uu             c    -g  u 
5' ccuu  cu  aacauggggguac ugcu  ug g
   ||||  ||  ||||||||||||| ||||  || a
3' ggag  ga  uuguaccuucgug auga  ac a
       gu  cu             a    aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OryCun2.0; GCA_000003625.1) Overlapping transcripts
CM000804.1: 36769770-36769837 [+]
antisense
ENSOCUT00000007074 ; LARP7-201; intron 9
Clustered miRNAs
< 10kb from ocu-mir-302c
ocu-mir-302bCM000804.1: 36769627-36769706 [+]
ocu-mir-302cCM000804.1: 36769770-36769837 [+]
ocu-mir-302aCM000804.1: 36769946-36770014 [+]
ocu-mir-302dCM000804.1: 36770109-36770176 [+]
ocu-mir-367CM000804.1: 36770233-36770300 [+]
Database links

Mature sequence ocu-miR-302c-5p

Accession MIMAT0036318
Sequence

8 - 

uuuaacauggggguaccugcug

 - 29

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ocu-miR-302c-3p

Accession MIMAT0036319
Sequence

43 - 

uaagugcuuccauguuucagugg

 - 65

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:23426804 "Discovery of pluripotency-associated microRNAs in rabbit preimplantation embryos and embryonic stem-like cells" Maraghechi P, Hiripi L, Toth G, Bontovics B, Bosze Z, Gocza E Reproduction. 145:421-437(2013).