Stem-loop sequence der-mir-2498b

AccessionMI0030917 (change log)
DescriptionDrosophila erecta miR-2498b stem-loop
Stem-loop
   --u      u   a      c      ga 
5'    uaaguc guu ugcaua uuuugu  g
      |||||| ||| |||||| ||||||  u
3'    auucgg caa acgugu aaaaca  u
   guc      c   c      -      gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 10617479-10617536 [-]
intergenic
Clustered miRNAs
< 10kb from der-mir-2498b
der-mir-992-1scaffold_4845: 10619176-10619234 [-]
der-mir-991-2scaffold_4845: 10619061-10619123 [-]
der-mir-2498ascaffold_4845: 10618951-10619010 [-]
der-mir-9681scaffold_4845: 10618728-10618783 [-]
der-mir-311b-2scaffold_4845: 10618294-10618368 [-]
der-mir-312-1scaffold_4845: 10618162-10618227 [-]
der-mir-311cscaffold_4845: 10618008-10618087 [-]
der-mir-310bscaffold_4845: 10617892-10617979 [-]
der-mir-992-2scaffold_4845: 10617702-10617760 [-]
der-mir-991-1scaffold_4845: 10617587-10617649 [-]
der-mir-2498bscaffold_4845: 10617479-10617536 [-]
der-mir-311b-1scaffold_4845: 10616837-10616911 [-]
der-mir-312-2scaffold_4845: 10616702-10616770 [-]
der-mir-311ascaffold_4845: 10616549-10616628 [-]
der-mir-310ascaffold_4845: 10616434-10616521 [-]
Database links

Mature sequence der-miR-2498b-5p

Accession MIMAT0039196
Sequence

1 - 

uuaagucuguuaugcauacu

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence der-miR-2498b-3p

Accession MIMAT0039197
Sequence

37 - 

aaugugcacaaccggcuuacu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).