Stem-loop sequence der-mir-2498a

AccessionMI0030916 (change log)
DescriptionDrosophila erecta miR-2498a stem-loop
Stem-loop
   ----       u   a    ua       ga 
5'     uuaaguc guu ugca  guuuugu  g
       ||||||| ||| ||||  |||||||  u
3'     aauucgg caa acgu  uaaaaca  u
   augu       c   c    -c       gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 10618951-10619010 [-]
intergenic
Clustered miRNAs
< 10kb from der-mir-2498a
der-mir-992-1scaffold_4845: 10619176-10619234 [-]
der-mir-991-2scaffold_4845: 10619061-10619123 [-]
der-mir-2498ascaffold_4845: 10618951-10619010 [-]
der-mir-9681scaffold_4845: 10618728-10618783 [-]
der-mir-311b-2scaffold_4845: 10618294-10618368 [-]
der-mir-312-1scaffold_4845: 10618162-10618227 [-]
der-mir-311cscaffold_4845: 10618008-10618087 [-]
der-mir-310bscaffold_4845: 10617892-10617979 [-]
der-mir-992-2scaffold_4845: 10617702-10617760 [-]
der-mir-991-1scaffold_4845: 10617587-10617649 [-]
der-mir-2498bscaffold_4845: 10617479-10617536 [-]
der-mir-311b-1scaffold_4845: 10616837-10616911 [-]
der-mir-312-2scaffold_4845: 10616702-10616770 [-]
der-mir-311ascaffold_4845: 10616549-10616628 [-]
der-mir-310ascaffold_4845: 10616434-10616521 [-]
Database links

Mature sequence der-miR-2498a-5p

Accession MIMAT0039194
Sequence

1 - 

uuaagucuguuaugcauaguuu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence der-miR-2498a-3p

Accession MIMAT0039195
Sequence

37 - 

aaucugcacaaccggcuuaaugu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).