Stem-loop sequence der-mir-991-1

AccessionMI0030913 (change log)
DescriptionDrosophila erecta miR-991-1 stem-loop
Stem-loop
   ---     cc    cuu          uuauu 
5'    uuucc  acuc   gcuuuaguac     u
      |||||  ||||   ||||||||||     u
3'    aaagg  ugag   cgaaauuaug     a
   uug     uu    -ac          cugua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 10617587-10617649 [-]
intergenic
Clustered miRNAs
< 10kb from der-mir-991-1
der-mir-992-1scaffold_4845: 10619176-10619234 [-]
der-mir-991-2scaffold_4845: 10619061-10619123 [-]
der-mir-2498ascaffold_4845: 10618951-10619010 [-]
der-mir-9681scaffold_4845: 10618728-10618783 [-]
der-mir-311b-2scaffold_4845: 10618294-10618368 [-]
der-mir-312-1scaffold_4845: 10618162-10618227 [-]
der-mir-311cscaffold_4845: 10618008-10618087 [-]
der-mir-310bscaffold_4845: 10617892-10617979 [-]
der-mir-992-2scaffold_4845: 10617702-10617760 [-]
der-mir-991-1scaffold_4845: 10617587-10617649 [-]
der-mir-2498bscaffold_4845: 10617479-10617536 [-]
der-mir-311b-1scaffold_4845: 10616837-10616911 [-]
der-mir-312-2scaffold_4845: 10616702-10616770 [-]
der-mir-311ascaffold_4845: 10616549-10616628 [-]
der-mir-310ascaffold_4845: 10616434-10616521 [-]
Database links

Mature sequence der-miR-991-5p

Accession MIMAT0039190
Sequence

1 - 

uuuccccacuccuugcuuuagu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence der-miR-991-3p

Accession MIMAT0039191
Sequence

41 - 

uuaaagccagaguuuggaaagu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).