Stem-loop sequence der-mir-9681

AccessionMI0030912 (change log)
DescriptionDrosophila erecta miR-9681 stem-loop
Stem-loop
   ---    c        g    a    uu 
5'    uuuc gacaaugc aucu ggcg  u
      |||| |||||||| |||| ||||  c
3'    aaag uuguuaug ugga ucgc  u
   uag    u        a    g    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 10618728-10618783 [-]
intergenic
Clustered miRNAs
< 10kb from der-mir-9681
der-mir-992-1scaffold_4845: 10619176-10619234 [-]
der-mir-991-2scaffold_4845: 10619061-10619123 [-]
der-mir-2498ascaffold_4845: 10618951-10619010 [-]
der-mir-9681scaffold_4845: 10618728-10618783 [-]
der-mir-311b-2scaffold_4845: 10618294-10618368 [-]
der-mir-312-1scaffold_4845: 10618162-10618227 [-]
der-mir-311cscaffold_4845: 10618008-10618087 [-]
der-mir-310bscaffold_4845: 10617892-10617979 [-]
der-mir-992-2scaffold_4845: 10617702-10617760 [-]
der-mir-991-1scaffold_4845: 10617587-10617649 [-]
der-mir-2498bscaffold_4845: 10617479-10617536 [-]
der-mir-311b-1scaffold_4845: 10616837-10616911 [-]
der-mir-312-2scaffold_4845: 10616702-10616770 [-]
der-mir-311ascaffold_4845: 10616549-10616628 [-]
der-mir-310ascaffold_4845: 10616434-10616521 [-]
Database links

Mature sequence der-miR-9681-5p

Accession MIMAT0039188
Sequence

1 - 

uuuccgacaaugcgaucuagg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence der-miR-9681-3p

Accession MIMAT0039189
Sequence

34 - 

ugagguaguauuguuugaaaga

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).