Stem-loop sequence dya-mir-992

AccessionMI0030894 (change log)
DescriptionDrosophila yakuba miR-992 stem-loop
Stem-loop
        u         c  g     auu    uu 
5' agugc uaguaucag aa gugua   uuug  u
   ||||| ||||||||| || |||||   ||||   
3' ucaug aucaugguc uu cacau   aaau  g
        c         a  g     --g    ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2R: 12723683-12723748 [+]
intergenic
Clustered miRNAs
< 10kb from dya-mir-992
dya-mir-992chr2R: 12723683-12723748 [+]
dya-mir-991chr2R: 12723801-12723862 [+]
dya-mir-2498chr2R: 12723909-12723977 [+]
dya-mir-9681chr2R: 12724136-12724190 [+]
dya-mir-311bchr2R: 12724551-12724629 [+]
dya-mir-312chr2R: 12724700-12724766 [+]
dya-mir-311achr2R: 12724827-12724906 [+]
dya-mir-310chr2R: 12724935-12725022 [+]
Database links

Mature sequence dya-miR-992-5p

Accession MIMAT0039164
Sequence

7 - 

uaguaucagcaagguguaauuu

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dya-miR-992-3p

Accession MIMAT0039165
Sequence

43 - 

uacacguuacugguacuacg

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).