Stem-loop sequence dse-mir-9685

AccessionMI0030893 (change log)
DescriptionDrosophila sechellia miR-9685 stem-loop
Stem-loop
   -uc       a  c     uc  u  ug 
5'    gacgucg cg agugu  gc gc  c
      ||||||| || |||||  || ||  c
3'    cugcagc gc ucacg  cg cg  a
   uga       c  -     -u  u  cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_0: 15993641-15993696 [-]
intergenic
Clustered miRNAs
< 10kb from dse-mir-9685
dse-mir-317scaffold_0: 15996588-15996679 [-]
dse-mir-9685scaffold_0: 15993641-15993696 [-]
dse-mir-277scaffold_0: 15987794-15987891 [-]
dse-mir-34scaffold_0: 15986848-15986943 [-]
Database links

Mature sequence dse-miR-9685-5p

Accession MIMAT0039162
Sequence

1 - 

ucgacgucgacgcaguguucg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dse-miR-9685-3p

Accession MIMAT0039163
Sequence

35 - 

ugcugcacucgccgacgucag

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).