Stem-loop sequence chi-mir-99b

AccessionMI0030846 (change log)
DescriptionCapra hircus miR-99b stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention chi-mir-99b
(6 sentences)

Stem-loop
        cc         ac   c    c - -   c 
5' ggcac  acccguaga  cga cuug g g ggc u
   |||||  |||||||||  ||| |||| | | |||  
3' cugug  ugggugucu  gcu gaac c c ccg u
        cc         gu   c    a a g   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr18: 62075592-62075661 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-99b
chi-mir-99bchr18: 62075592-62075661 [+]
chi-let-7echr18: 62075747-62075855 [+]
chi-mir-125achr18: 62076263-62076336 [+]
Database links

Mature sequence chi-miR-99b-5p

Accession MIMAT0036314
Sequence

7 - 

cacccguagaaccgaccuugcg

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-99b-3p

Accession MIMAT0036315
Sequence

45 - 

caagcucgugucuguggguc

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).