Stem-loop sequence chi-mir-99a

AccessionMI0030845 (change log)
DescriptionCapra hircus miR-99a stem-loop
Gene family MIPF0000033; mir-10
Literature search

9 open access papers mention chi-mir-99a
(25 sentences)

Stem-loop
   cc          a         uc   u      g  aag 
5'   cauuggcaua acccguaga  cga cuugug ug   u
     |||||||||| |||||||||  ||| |||||| ||    
3'   gugacugugu uggguaucu  gcu gaacac gc   g
   gu          c         uc   c      -  cag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr1: 20810454-20810534 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-99a
chi-mir-99achr1: 20810454-20810534 [-]
chi-let-7cchr1: 20809702-20809809 [-]
Database links

Mature sequence chi-miR-99a-5p

Accession MIMAT0036312
Sequence

13 - 

aacccguagauccgaucuugu

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-99a-3p

Accession MIMAT0036313
Sequence

50 - 

caagcucgcuucuaugggucugu

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).