Stem-loop sequence chi-mir-98

AccessionMI0030844 (change log)
DescriptionCapra hircus miR-98 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention chi-mir-98
(1 sentences)

Stem-loop
   a   cuc    -     ug   u                 u    ---------      aggg 
5'  gga   ugcu caugc  ggg gagguaguaaguuguau guug         uggggu    a
    |||   |||| |||||  ||| ||||||||||||||||| ||||         ||||||    u
3'  cuu   acga gugug  ccc uuucaucauucaacaua caau         accccg    u
   a   -ac    u     gu   -                 u    agaagauua      gauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 90705668-90705786 [-]
intergenic
Database links

Mature sequence chi-miR-98-5p

Accession MIMAT0036310
Sequence

22 - 

ugagguaguaaguuguauuguu

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-98-3p

Accession MIMAT0036311
Sequence

80 - 

cuauacaacuuacuacuuuccc

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).