Stem-loop sequence chi-mir-96

AccessionMI0030843 (change log)
DescriptionCapra hircus miR-96 stem-loop
Gene family MIPF0000072; mir-96
Literature search

1 open access papers mention chi-mir-96
(1 sentences)

Stem-loop
   ccacuac    -     gg  g cu        a      uu      ---   uc 
5'        cauc ugcuu  cc a  uuggcacu gcacau  uugcuu   gug  u
          |||| |||||  || |  |||||||| ||||||  ||||||   |||   
3'        guag acgaa  gg u  aaccguga cgugua  aacgag   cgc  c
   ------c    g     aa  g au        -      cu      ucu   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr4: 96232297-96232399 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-96
chi-mir-183chr4: 96232544-96232653 [-]
chi-mir-96chr4: 96232297-96232399 [-]
chi-mir-182chr4: 96226171-96226274 [-]
Database links

Mature sequence chi-miR-96

Accession MIMAT0036309
Sequence

24 - 

uuuggcacuagcacauuuuug

 - 44

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).