Stem-loop sequence chi-mir-92b

AccessionMI0030840 (change log)
DescriptionCapra hircus miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

2 open access papers mention chi-mir-92b
(2 sentences)

Stem-loop
   --ccca   a         g     uu  u   c     guguu 
5'       uuc uucaugggu gggau  gu gca ugcuu     a
         ||| ||||||||| |||||  || ||| |||||      
3'       aag agguguccg cccug  ca cgu augaa     u
   ggagca   a         g     uu  -   u     augua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 40074814-40074900 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-92b
chi-mir-106achrX: 40075491-40075571 [-]
chi-mir-18bchrX: 40075324-40075417 [-]
chi-mir-20bchrX: 40075091-40075165 [-]
chi-mir-92bchrX: 40074814-40074900 [-]
chi-mir-363chrX: 40074650-40074760 [-]
Database links

Mature sequence chi-miR-92b

Accession MIMAT0036304
Sequence

53 - 

uauugcacuugucccggccugu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).