Stem-loop sequence chi-mir-873

AccessionMI0030835 (change log)
DescriptionCapra hircus miR-873 stem-loop
Gene family MIPF0000390; mir-873
Literature search

1 open access papers mention chi-mir-873
(1 sentences)

Stem-loop
   ----------uaa       u ca   g a      ug g        a  ga 
5'              guuugug g  uuu c ggaacu  u agucuccu uu  a
                ||||||| |  ||| | ||||||  | |||||||| ||  c
3'              uaaacac c  aag g ccuuga  a ucggagga aa  a
   uuacucauccuuc       c ac   g c      gu g        c  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr8: 15366430-15366528 [+]
intergenic
Database links

Mature sequence chi-miR-873-5p

Accession MIMAT0036294
Sequence

17 - 

ugcaggaacuugugagucu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-873-3p

Accession MIMAT0036295
Sequence

54 - 

gaggcugaugaguucccgggaa

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).