Stem-loop sequence chi-mir-7

AccessionMI0030831 (change log)
DescriptionCapra hircus miR-7 stem-loop
Gene family MIPF0000022; mir-7
Literature search

3 open access papers mention chi-mir-7
(7 sentences)

Stem-loop
   uuauacagagccuguagaaaauguagaagauucagu  augu      a  u        a     a       u      --     a 
5'                                     gg    uggucu gu cugugugg agacu gugauuu guuguu  uuuag u
                                       ||    |||||| || |||||||| ||||| ||||||| ||||||  |||||  
3'                                     cc    accgga ca gguauacc ucuga cacuaaa caacag  aaguc a
   --------------------------caggacaucu  --gu      -  c        g     -       -      cu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr8: 78274063-78274209 [-]
intergenic
Database links

Mature sequence chi-miR-7-5p

Accession MIMAT0036288
Sequence

58 - 

uggaagacuagugauuuuguuguu

 - 81

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-7-3p

Accession MIMAT0036289
Sequence

101 - 

aacaaaucacagucugccaua

 - 121

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).