Stem-loop sequence chi-mir-671

AccessionMI0030830 (change log)
DescriptionCapra hircus miR-671 stem-loop
Gene family MIPF0000358; mir-671
Literature search

2 open access papers mention chi-mir-671
(4 sentences)

Stem-loop
   ---  c    -a      ----a    a        a   a      ga           -u   g 
5'    gc gccg  ccuggc     ggcc ggaagagg gga gcccug  ggggcuggagg  gau g
      || ||||  ||||||     |||| |||||||| ||| ||||||  |||||||||||  |||  
3'    cg uggu  ggaccg     ccgg ccuuuucc ccu cgggac  ucuuggccucc  uug a
   aga  -    cg      aggug    g        a   -      --           uu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr4: 116586507-116586627 [+]
intergenic
Database links

Mature sequence chi-miR-671-5p

Accession MIMAT0036286
Sequence

29 - 

aggaagcccuggaggggcuggagg

 - 52

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-671-3p

Accession MIMAT0036287
Sequence

68 - 

uccgguucucagggcuccacc

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).