Stem-loop sequence chi-mir-665

AccessionMI0030829 (change log)
DescriptionCapra hircus miR-665 stem-loop
Gene family MIPF0000404; mir-665
Stem-loop
   ccu    -   -    u   -                -   cc  g  c 
5'    ggag gag gguc ccu ugaggggucuuggccu cug  ca ga u
      |||| ||| |||| ||| |||||||||||||||| |||  || || c
3'    ucuc uuc ucgg gga acuccccggagccgga gac  gu cu u
   -cc    a   g    c   c                u   ca  a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 66954668-66954763 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-665
chi-mir-665chr21: 66954668-66954763 [+]
chi-mir-433chr21: 66962261-66962390 [+]
chi-mir-433chr21: 66964297-66964426 [+]
Database links

Mature sequence chi-miR-665

Accession MIMAT0036285
Sequence

55 - 

accaguaggccgaggccccu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).