Stem-loop sequence chi-mir-592

AccessionMI0030824 (change log)
DescriptionCapra hircus miR-592 stem-loop
Gene family MIPF0000340; mir-592
Literature search

1 open access papers mention chi-mir-592
(2 sentences)

Stem-loop
   --------------u   --a     c     ca        a    c       -     g 
5'                gau   uuaug cauga  uuguguca uaug gaugaug ugugu a
                  |||   ||||| |||||  |||||||| |||| ||||||| |||||  
3'                cug   aaugc guacu  aacgcagu gugc cuacugc acacg u
   aauuaaccggcaacc   cag     a     ac        g    a       g     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr4: 93889720-93889828 [-]
intergenic
Database links

Mature sequence chi-miR-592

Accession MIMAT0036280
Sequence

19 - 

uugugucaauaugcgaugaugu

 - 40

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).