Stem-loop sequence chi-mir-544

AccessionMI0030821 (change log)
DescriptionCapra hircus miR-544 stem-loop
Gene family MIPF0000436; mir-544
Literature search

1 open access papers mention chi-mir-544
(2 sentences)

Stem-loop
   --ucag   uu      cua    u           -     u   -ga  c 
5'       auu  caucac   ggga cuuguuaaaag gcaga ucu   uu a
         |||  ||||||   |||| ||||||||||| ||||| |||   ||  
3'       uaa  guagug   cccu gaacgauuuuu cgucu aga   ag g
   ucuucg   uc      -aa    u           a     u   acc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67124523-67124623 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-544
chi-mir-376echr21: 67116496-67116601 [+]
chi-mir-376cchr21: 67116853-67116964 [+]
chi-mir-376dchr21: 67117225-67117334 [+]
chi-mir-376bchr21: 67117609-67117712 [+]
chi-mir-376achr21: 67117973-67118087 [+]
chi-mir-1185chr21: 67119939-67120050 [+]
chi-mir-381chr21: 67121597-67121724 [+]
chi-mir-487bchr21: 67122099-67122216 [+]
chi-mir-544chr21: 67124523-67124623 [+]
chi-mir-655chr21: 67125414-67125530 [+]
chi-mir-3959chr21: 67127378-67127478 [+]
chi-mir-487achr21: 67127794-67127896 [+]
chi-mir-382chr21: 67130720-67130845 [+]
chi-mir-134chr21: 67131102-67131209 [+]
chi-mir-485chr21: 67131798-67131912 [+]
chi-mir-382chr21: 67132394-67132519 [+]
chi-mir-134chr21: 67132776-67132883 [+]
chi-mir-485chr21: 67133472-67133586 [+]
Database links

Mature sequence chi-miR-544-5p

Accession MIMAT0036276
Sequence

23 - 

ucuuguuaaaaggcagauucu

 - 43

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).