Stem-loop sequence chi-mir-543

AccessionMI0030820 (change log)
DescriptionCapra hircus miR-543 stem-loop
Gene family MIPF0000110; mir-329
Literature search

1 open access papers mention chi-mir-543
(2 sentences)

Stem-loop
   gcugagcugccgaa   uc    cc  u      u          u  -     ucuu     - uuu 
5'               uga  cuga  ug ggugcu aaggagaagu gc ccgug    uuucg c   a
                 |||  ||||  || |||||| |||||||||| || |||||    ||||| |   u
3'               gcu  gacu  ac cuauga uuuuucuuca cg ggcgc    aaagc g   a
   ------------aa   cc    ua  -      c          -  u     uuac     a ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67110457-67110579 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-543
chi-mir-411achr21: 67101691-67101817 [+]
chi-mir-380chr21: 67103397-67103499 [+]
chi-mir-411bchr21: 67103557-67103658 [+]
chi-mir-1197chr21: 67103896-67104024 [+]
chi-mir-323achr21: 67104063-67104176 [+]
chi-mir-758chr21: 67104376-67104476 [+]
chi-mir-329bchr21: 67105074-67105197 [+]
chi-mir-329achr21: 67105386-67105492 [+]
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
chi-mir-376echr21: 67116496-67116601 [+]
chi-mir-376cchr21: 67116853-67116964 [+]
chi-mir-376dchr21: 67117225-67117334 [+]
chi-mir-376bchr21: 67117609-67117712 [+]
chi-mir-376achr21: 67117973-67118087 [+]
chi-mir-1185chr21: 67119939-67120050 [+]
Database links

Mature sequence chi-miR-543-5p

Accession MIMAT0036274
Sequence

23 - 

accuguggugcuuaaggag

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-543-3p

Accession MIMAT0036275
Sequence

77 - 

aaacauucgcggugcacuucu

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).