Stem-loop sequence chi-mir-542

AccessionMI0030819 (change log)
DescriptionCapra hircus miR-542 stem-loop
Gene family MIPF0000185; mir-542
Literature search

2 open access papers mention chi-mir-542
(5 sentences)

Stem-loop
   guca      ca a ac       auc    gg    uca         -a   c 
5'     aggaug  c g  cucagac   ucgg  auca   ugucacgag  uac a
       ||||||  | |  |||||||   ||||  ||||   |||||||||  |||  
3'     uucuac  g c  gggucug   aguc  uagu   acaguguuc  gug c
   --ac      uc c ga       gaa    aa    uag         ac   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 40340880-40340988 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-542
chi-mir-424chrX: 40346458-40346566 [-]
chi-mir-542chrX: 40340880-40340988 [-]
chi-mir-450chrX: 40339836-40339928 [-]
Database links

Mature sequence chi-miR-542-5p

Accession MIMAT0036272
Sequence

28 - 

ucggggaucaucaugucacgaga

 - 50

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-542-3p

Accession MIMAT0036273
Sequence

65 - 

ugugacagauugauaacuga

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).