Stem-loop sequence chi-mir-502a

AccessionMI0030814 (change log)
DescriptionCapra hircus miR-502a stem-loop
Gene family MIPF0000139; mir-500
Literature search

1 open access papers mention chi-mir-502a
(1 sentences)

Stem-loop
   u        -    -        cuc  ug     uag   -  u 
5'  gcccaccc cucu aauccuug   uc  ggugc   ugc ug c
    |||||||| |||| ||||||||   ||  |||||   ||| ||  
3'  cggguggg gaga uuaggaac   ag  ccacg   gcg ac u
   u        a    c        ---  gu     -ua   u  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 82599100-82599184 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-502a
chi-mir-502bchrX: 82604898-82604980 [-]
chi-mir-362chrX: 82604414-82604511 [-]
chi-mir-500chrX: 82603133-82603216 [-]
chi-mir-660chrX: 82601027-82601104 [-]
chi-mir-502achrX: 82599100-82599184 [-]
Database links

Mature sequence chi-miR-502a

Accession MIMAT0036265
Sequence

52 - 

augcaccuggacaaggauuc

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).