Stem-loop sequence chi-mir-499

AccessionMI0030812 (change log)
DescriptionCapra hircus miR-499 stem-loop
Gene family MIPF0000173; mir-499
Literature search

3 open access papers mention chi-mir-499
(3 sentences)

Stem-loop
   --       ccu   c --c        c   u  ua        a          acucc 
5'   ucugucc   gca c   ggggcggg ggc gu  agacuugc gugauguuua     u
     |||||||   ||| |   |||||||| ||| ||  |||||||| ||||||||||     c
3'   ggacggg   cgu g   cccugccc ucg cg  ucugaacg cacuacaagu     u
   ug       -uc   c cac        u   u  ug        a          gcacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr13: 65701240-65701359 [+]
intergenic
chr13: 65705042-65705161 [+]
intergenic
Database links

Mature sequence chi-miR-499-5p

Accession MIMAT0036261
Sequence

31 - 

uuaagacuugcagugauguuu

 - 51

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-499-3p

Accession MIMAT0036262
Sequence

67 - 

gaacaucacagcaagucugugc

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).