Stem-loop sequence chi-mir-496

AccessionMI0030810 (change log)
DescriptionCapra hircus miR-496 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   gacacgucagaag    caucc    cg      c   u        u     gu         uua 
5'              ccag     gagu  gguacu gaa ggagguug ccaug  guguucauu   u
                ||||     ||||  |||||| ||| |||||||| |||||  |||||||||    
3'              gguu     cuua  ucauga cuu ccucuaac gguac  uaugaguag   u
   ------------g    --cuu    aa      -   u        c     au         uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67138399-67138519 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-496
chi-mir-382chr21: 67130720-67130845 [+]
chi-mir-134chr21: 67131102-67131209 [+]
chi-mir-485chr21: 67131798-67131912 [+]
chi-mir-382chr21: 67132394-67132519 [+]
chi-mir-134chr21: 67132776-67132883 [+]
chi-mir-485chr21: 67133472-67133586 [+]
chi-mir-154achr21: 67137564-67137668 [+]
chi-mir-154bchr21: 67137892-67138000 [+]
chi-mir-496chr21: 67138399-67138519 [+]
chi-mir-377chr21: 67139994-67140124 [+]
chi-mir-409chr21: 67142870-67142983 [+]
chi-mir-412chr21: 67142997-67143118 [+]
chi-mir-369chr21: 67143159-67143265 [+]
chi-mir-410chr21: 67143473-67143597 [+]
chi-mir-323bchr21: 67144000-67144109 [+]
Database links

Mature sequence chi-miR-496-5p

Accession MIMAT0036257
Sequence

23 - 

gagucggguacucgaaugga

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-496-3p

Accession MIMAT0036258
Sequence

75 - 

ugaguauuacauggccaaucu

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).