Stem-loop sequence chi-mir-495

AccessionMI0030809 (change log)
DescriptionCapra hircus miR-495 stem-loop
Gene family MIPF0000110; mir-329
Literature search

1 open access papers mention chi-mir-495
(2 sentences)

Stem-loop
   gcacguccgugcccaucagg     ccgc  gu   u          c  -       cu     - uug 
5'                     gcuga    ug  acc gaaaagaagu gc ccauguu  uuucg c   a
                       |||||    ||  ||| |||||||||| || |||||||  ||||| |   u
3'                     cgacu    ac  ugg uuuuucuuca cg gguacaa  aaagc g   a
   -------------------g     cuaa  ug   c          -  u       ac     a ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67111896-67112016 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-495
chi-mir-380chr21: 67103397-67103499 [+]
chi-mir-411bchr21: 67103557-67103658 [+]
chi-mir-1197chr21: 67103896-67104024 [+]
chi-mir-323achr21: 67104063-67104176 [+]
chi-mir-758chr21: 67104376-67104476 [+]
chi-mir-329bchr21: 67105074-67105197 [+]
chi-mir-329achr21: 67105386-67105492 [+]
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
chi-mir-376echr21: 67116496-67116601 [+]
chi-mir-376cchr21: 67116853-67116964 [+]
chi-mir-376dchr21: 67117225-67117334 [+]
chi-mir-376bchr21: 67117609-67117712 [+]
chi-mir-376achr21: 67117973-67118087 [+]
chi-mir-1185chr21: 67119939-67120050 [+]
chi-mir-381chr21: 67121597-67121724 [+]
Database links

Mature sequence chi-miR-495-3p

Accession MIMAT0036256
Sequence

79 - 

aaacaaacauggugcacuucuu

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).