Stem-loop sequence chi-mir-494

AccessionMI0030808 (change log)
DescriptionCapra hircus miR-494 stem-loop
Gene family MIPF0000018; mir-154
Literature search

3 open access papers mention chi-mir-494
(13 sentences)

Stem-loop
   uuuuugacca   cuuaucuuc      u            a       -   c   -  uuu 
5'           ggg         gauacu gaaggagagguu uccgugu ugu uuc uc   a
             |||         |||||| |||||||||||| ||||||| ||| ||| ||   u
3'           ccc         cuauga uuuuuucuccaa gggcaca aca aag ag   u
   -------cca   -----uaaa      -            a       u   -   u  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67108251-67108363 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-494
chi-mir-379chr21: 67100421-67100550 [+]
chi-mir-411achr21: 67101691-67101817 [+]
chi-mir-380chr21: 67103397-67103499 [+]
chi-mir-411bchr21: 67103557-67103658 [+]
chi-mir-1197chr21: 67103896-67104024 [+]
chi-mir-323achr21: 67104063-67104176 [+]
chi-mir-758chr21: 67104376-67104476 [+]
chi-mir-329bchr21: 67105074-67105197 [+]
chi-mir-329achr21: 67105386-67105492 [+]
chi-mir-494chr21: 67108251-67108363 [+]
chi-mir-543chr21: 67110457-67110579 [+]
chi-mir-495chr21: 67111896-67112016 [+]
chi-mir-3958chr21: 67113857-67113960 [+]
chi-mir-376echr21: 67116496-67116601 [+]
chi-mir-376cchr21: 67116853-67116964 [+]
chi-mir-376dchr21: 67117225-67117334 [+]
chi-mir-376bchr21: 67117609-67117712 [+]
chi-mir-376achr21: 67117973-67118087 [+]
Database links

Mature sequence chi-miR-494

Accession MIMAT0036255
Sequence

70 - 

ugaaacauacacgggaaaccucu

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).