Stem-loop sequence chi-mir-493

AccessionMI0030807 (change log)
DescriptionCapra hircus miR-493 stem-loop
Gene family MIPF0000230; mir-493
Literature search

5 open access papers mention chi-mir-493
(16 sentences)

Stem-loop
   ----ggggcucccucuggcccc        u                    cauuc  u 
5'                       cagggccu guacaugguaggcuuucauu     gu u
                         |||||||| ||||||||||||||||||||     ||  
3'                       gucccgga cgugugucaucuggaagugg     ca g
   agguaaaugaacgacggaccgu        c                    -cuua  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 66936079-66936193 [+]
intergenic
chr21: 66941247-66941361 [+]
intergenic
Database links

Mature sequence chi-miR-493-5p

Accession MIMAT0036253
Sequence

26 - 

uuguacaugguaggcuuucauu

 - 47

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-493-3p

Accession MIMAT0036254
Sequence

67 - 

ugaaggucuacugugugccagg

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).