Stem-loop sequence chi-mir-487b

AccessionMI0030804 (change log)
DescriptionCapra hircus miR-487b stem-loop
Gene family MIPF0000018; mir-154
Literature search

2 open access papers mention chi-mir-487b
(3 sentences)

Stem-loop
   uuucuuuccc     aacc         ug        uuau      c u     uuuua 
5'           gugcu    uuugguacu  gagagugg    cccugu c guucg     c
             |||||    |||||||||  ||||||||    |||||| | |||||      
3'           cgcga    gaacuauga  uuuucacc    gggaca g uaagc     u
   --augccaga     ----         cu        uacu      u c     uguac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67122099-67122216 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-487b
chi-mir-3958chr21: 67113857-67113960 [+]
chi-mir-376echr21: 67116496-67116601 [+]
chi-mir-376cchr21: 67116853-67116964 [+]
chi-mir-376dchr21: 67117225-67117334 [+]
chi-mir-376bchr21: 67117609-67117712 [+]
chi-mir-376achr21: 67117973-67118087 [+]
chi-mir-1185chr21: 67119939-67120050 [+]
chi-mir-381chr21: 67121597-67121724 [+]
chi-mir-487bchr21: 67122099-67122216 [+]
chi-mir-544chr21: 67124523-67124623 [+]
chi-mir-655chr21: 67125414-67125530 [+]
chi-mir-3959chr21: 67127378-67127478 [+]
chi-mir-487achr21: 67127794-67127896 [+]
chi-mir-382chr21: 67130720-67130845 [+]
chi-mir-134chr21: 67131102-67131209 [+]
chi-mir-485chr21: 67131798-67131912 [+]
chi-mir-382chr21: 67132394-67132519 [+]
chi-mir-134chr21: 67132776-67132883 [+]
chi-mir-485chr21: 67133472-67133586 [+]
Database links

Mature sequence chi-miR-487b-5p

Accession MIMAT0036248
Sequence

14 - 

cuaaccuuugguacuuggaga

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-487b-3p

Accession MIMAT0036249
Sequence

71 - 

aaucguacagggucauccacuu

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).